Archives

  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10
  • Influenza Hemagglutinin (HA) Peptide: Precision HA Tag fo...

    2026-02-01

    Influenza Hemagglutinin (HA) Peptide: Precision HA Tag for Protein Detection and Purification

    Executive Summary: The Influenza Hemagglutinin (HA) Peptide, sequence YPYDVPDYA, is a synthetic, nine-residue epitope tag widely used for protein detection and purification workflows in molecular biology (APExBIO). It binds specifically and competitively to anti-HA antibodies, enabling efficient elution of HA-tagged fusion proteins (Dong et al. 2025, DOI link). The HA tag exhibits high solubility: ≥55.1 mg/mL in DMSO, ≥100.4 mg/mL in ethanol, and ≥46.2 mg/mL in water, supporting diverse buffer conditions. APExBIO's A6004 HA Peptide product assures >98% purity by HPLC and MS, providing reliable performance in immunoprecipitation, protein-protein interaction, and purification studies. Proper storage (-20°C, desiccated) maintains peptide stability; long-term solution storage is not recommended (product page).

    Biological Rationale

    The HA tag is derived from the human influenza hemagglutinin protein, specifically residues 98–106 (YPYDVPDYA) (see benchmark epitope analysis). This peptide sequence serves as a universal epitope, recognized by high-affinity monoclonal and polyclonal anti-HA antibodies. The tag is genetically fused to proteins of interest, allowing detection or purification independent of the protein's native sequence or structure. Its small size (nine amino acids, ~1 kDa) minimizes interference with protein folding or function, making it a preferred tag for probing protein localization, expression, and interactions. The HA tag system is compatible with a broad range of host organisms, including mammalian, yeast, and bacterial expression systems (see protocol comparison).

    Mechanism of Action of Influenza Hemagglutinin (HA) Peptide

    The HA peptide tag mediates its function via specific and high-affinity binding to anti-HA antibodies. In immunoprecipitation workflows, anti-HA magnetic beads or immobilized antibodies selectively capture HA-tagged fusion proteins from complex lysates. Free synthetic HA peptide (such as APExBIO A6004) can then be added in excess, competitively displacing the bound fusion protein by saturating the antibody binding sites. This mechanism enables gentle, high-yield elution of intact fusion proteins without harsh denaturation conditions or proteolytic cleavage. The competitive binding mechanism is well-characterized and allows for precise control over elution stringency and buffer compatibility (comprehensive protocol resource).

    Evidence & Benchmarks

    • HA tag (YPYDVPDYA) enables robust, antibody-mediated immunoprecipitation and detection of fusion proteins in mammalian and yeast systems (site summary).
    • APExBIO's Influenza Hemagglutinin (HA) Peptide (A6004) is validated to >98% purity by HPLC and mass spectrometry, minimizing non-specific background (certification).
    • Competitive elution with HA peptide preserves protein-protein interactions during immunoprecipitation, supporting interaction network studies (Dong et al. 2025, DOI link).
    • High solubility in DMSO (≥55.1 mg/mL), ethanol (≥100.4 mg/mL), and water (≥46.2 mg/mL) allows use in a wide variety of experimental buffers and conditions (specification).
    • HA tag fusion does not significantly disrupt protein folding or function due to its minimal size (translational insight).

    Applications, Limits & Misconceptions

    The Influenza Hemagglutinin (HA) Peptide enables multiple molecular biology and biochemistry applications:

    • Immunoprecipitation with Anti-HA Antibody: Highly specific capture and elution of HA-tagged proteins for downstream analysis.
    • Protein-Protein Interaction Studies: Preservation of complex integrity during elution supports mapping of interactomes and signaling pathways.
    • Protein Purification: Affinity purification from complex samples using anti-HA columns or beads.
    • Epitope Tag for Protein Detection: HA tag is compatible with Western blot, immunofluorescence, and ELISA detection platforms.

    For advanced use-cases, such as studying transient or weak protein interactions, the HA system offers gentle elution conditions that minimize artefactual dissociation (see advanced applications). In contrast to larger tags, the HA peptide limits steric hindrance and immunogenicity. This article extends existing reviews by providing granular purity and solubility benchmarks for the A6004 product.

    Common Pitfalls or Misconceptions

    • The HA peptide will not facilitate purification if the target protein is expressed at very low levels or is poorly accessible to antibodies.
    • It does not confer protease resistance; tagged proteins may still be susceptible to degradation during extraction.
    • Competitive elution with synthetic HA peptide is ineffective if antibody saturation is incomplete or if binding affinity is suboptimal.
    • Long-term storage of peptide solutions, even at -20°C, is not recommended due to risk of hydrolysis or aggregation.
    • The HA tag is not suitable for in vivo imaging unless fused to a detectable reporter (e.g., GFP).

    Workflow Integration & Parameters

    To integrate the Influenza Hemagglutinin (HA) Peptide (A6004) into research workflows, users should clone the HA tag DNA sequence (TACCCCTATGACGTGCCGGAC) in-frame with the protein of interest. Expression is typically achieved in a suitable vector with a C- or N-terminal HA fusion. For immunoprecipitation, lysates are incubated with anti-HA beads, and bound proteins are eluted by adding 1–2 mg/mL synthetic HA peptide in PBS or compatible buffer at 4°C for 30–60 min. The product's high solubility ensures compatibility with most buffer systems. For optimal performance, reconstitute lyophilized peptide in sterile water, DMSO, or ethanol immediately prior to use and store aliquots desiccated at -20°C (handling protocol).

    This article clarifies operational details and extends prior resources by providing explicit quantitative reconstitution and elution guidelines not present in older reviews (protocol extension).

    Conclusion & Outlook

    The Influenza Hemagglutinin (HA) Peptide tag system, as supplied in APExBIO's A6004 format, offers a validated, high-purity solution for protein detection, purification, and interaction studies. Its small size, high solubility, and sequence specificity underpin its status as a gold-standard molecular biology peptide tag. Ongoing advances in antibody engineering and affinity matrix design may further expand its applications in translational research, including precision oncology and exosome biology. For comprehensive protocols and troubleshooting, researchers are encouraged to consult both the product page and up-to-date methodological resources (APExBIO A6004).